XDestinyX
XDestinyX XDestinyX
  • 14-02-2017
  • Mathematics
contestada

What is it plz tell me

What is it plz tell me class=

Respuesta :

lilmissarieli
lilmissarieli lilmissarieli
  • 14-02-2017
Maybe 10 cups idk try it
Answer Link

Otras preguntas

what are the list of catalysts that can be used for hydrogenation of nitrobenzene???​
hey there, can help me to solve thiswhat is the value of x, if [tex]x = \cos {}^{2} (60) + \sin {}^{2} (60) [/tex]​
Cylinder A has a volume of 6 cubic units, and a height of 3 units. Cylinder B has the same base area and height, but its slant height is 4 units. What is the vo
ASAP, DUE IN 20 MINUTESWhat are 3 reasons that France stopped paying for voyages to Canada?∆ The New World appeared worthless∆The cost was too hight∆They did no
Question 1 (2 points) Which term best describes the process by which signs, symbols, and behaviors are used to exchange information and create meaning? interact
Which of the following conditions are required for natural selection? I. overproduction of offspring II. competition for resources III. genetic variation IV. na
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
which number has an absolute value greater than 5? -6 -5 0 5
Can anybody tell me what’s going on here?
Find the circumference of the circle. Use 3.14 for the value of ", Round your answer to the nearest tenth.