25roev05 25roev05

11-02-2022
Biology

contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570 10818570

11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

What are Henry IV kids name

60 pts Pls help! A tunnel on a bike trail is being designed similar to the picture below.

Which area did the United States acquire in the 1840s, and how did it acquire the land? A.) The United States purchased Alaska from the British. B.) Thomas Jef

What is the role of UAE federal national council in the field of development?

Describe two teaching method that you could use to create an atmosphere of excitement when teaching your main student in secondary school or examine the major q

The roof of a two-story house makes an angle of 30°with the horizontal. A ball rollingdown the roof rolls off the edge at a speed of 5.0m/s. The distance to the

Jim has gotten scores of 93 and 63 on his first two tests. What score must he get on his third test to keep an average of 80 or greater?

What is a 1/2 divided by a 1/4 simplified?

PLEASE HELP ILL DO ANYTHIG!!

In order for a repetition to be reproduced unambiguously, what three attributes are needed to convey the proper instructions?