victoriaahernandez8 victoriaahernandez8

10-11-2021
Mathematics

contestada

If the legs of a right triangle are 6 and 8, then the hypotenuse is______

If the legs of a right triangle are 6 and 8 then the hypotenuse is class=

Respuesta :

Аноним Аноним

10-11-2021

Answer:

6^2 + 8^2 = 36 + 64 = 100 = 10^2. The hypotenuse is 10.

Answer Link

Otras preguntas

memes are life dont delete if u do then u know im right

The rectangle is the image after a dilation with the center of dilation at the origin of rectangle ABCD. The pre-image of A': point A has coordinates of (4.3.2)

help heleleleelelelelelleellellelelelle

What is the distance between point (5, 9) and its reflection across the y-axis?

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’ What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

Angela was looking at 17 different colors to paint her bedroom. She liked about one fourth of the colors. About how many colors did she like?

when a skin cell completes one round of the cell cycle, what are the products

Write the ratio as a fraction in simplest form. 35 girls:15 boys

This Organization gives advice and make judgments on disputes over International law. The United States is a member. Which international organization does this

Write the equation of the line that contains the points (4, -7) and (1,5). The slope of the line that contains the points (4, -7) and (1,5) is