sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

f(1) = 25 ƒ(n) = f(n − 1) • ( -1/5 ) f(3) = Please help :)

evelyn opened a small business boutique catering to a very narrow defined target market Evelyn competitive edge is

find the volume .round to the nearest tenth

my reading experience

Which land feature is most likely to be be formed by wind erosion?

1 2 6 8 9 Which of the following could result in the extinction of a species? O harsh restrictions on poachers increase in the habitat size of a species O addin

4 friends are choosing from 8 different drinks at a freshment stand. What is the probability that at least 2 if the friends order the same drink?

The slope of the line below is 2. Use the coordinates of the labeled point to find the point-slope equation of the line.

how does compensation useful to the prospect

How can wind erosion be prevented? Select all that apply. A. planting vegetation barriers B.creating plowed ridges C. covering the surface of the ground with le