zariahicks2008 zariahicks2008

13-01-2020
Mathematics

contestada

95000 citizens were asked what was their favorite pet. how many choose dog. (picture up above)

95000 citizens were asked what was their favorite pet how many choose dog picture up above class=

Respuesta :

fahida3648 fahida3648

13-01-2020

The answer is 25650 I think instead of asking you can use apps like Socratic and photomath

Answer Link

Otras preguntas

Where does the comma go in this sentence His entire outlook it seemed had changed

this is the body measurement taken from the shoulder down to the tip of the bust a. bust line b.bust point hight c.bust point width d. waist line

Suppose you decide to run at least 7.5 miles per week during the week to train for the cross-country season in the fall. During one week, you run 2 miles on Sun

How you do this work ?

Which expression is equivalent to one over fivem − 20? one over five(m − 4) one over five(m − 100) 5(m − 4) 5(m − 100)

Explain the form used for serving as if you were teaching someone.

In which community is Guthi prevalent

Crime is believed to be a product of transitional neighborhoods that manifest value conflict according ________ theory.

I need help I am timed please 1/4c+5/3c-4=2-1/12 What dose c equalu

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t