xdirewlf9434 xdirewlf9434

11-03-2024
Mathematics

contestada

Find the derivative.
f(x)=2x⁴-6x³+1, find f(x)
O 8x³-18x²-7
O 4x³+3x²-7
O 8x³-18x²
O 4x³+3x²

Respuesta :

Otras preguntas

...........................

Two middle school students often wear clothing with slogans like “Vegan All Day, Every Day, “The Moo Moo is a No No,” and “Be Cool, Be Vegan.” The students beli

NO LINKS PLEASE. Use the reading below to answer the question. Analysis: How would you describe the tone of this section of President Kennedy’s speech? Cite te

As the territory of Africanized bees continues to expand, what is the most likely outcome?

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

raise f to the 8th power, then add 7 to the result

ASAP, DUE IN 20 MINUTESWhat are 3 reasons that France stopped paying for voyages to Canada?∆ The New World appeared worthless∆The cost was too hight∆They did no

What is the topic of this paragraph? health and safety in Elizabethan England health and safety in modern England symptoms of the plague symptoms of infectious

8 Spoints What was one benefit of the post Sputnik space race for average American consumers

Which set of side lengths create a right triangle ? A(10,28,and 29) B(6, 8,and 13) C(7, 12 and 14) D( 8 , 15 and 17)